LITMIR.BIZ

       Option 1. Collect a swab sample of the endometrium and uterine lumen using traditional techniques (see Chapter 12). The swab tip is placed inside a sterile 15 ml centrifuge tube and submitted for qPCR analysis. The sample should be kept refrigerated or shipped on ice during transport to the laboratory to help maintain DNA integrity. Freezing or excessive heat should be avoided.

       Option 2. Collect a low volume uterine lavage sample using traditional techniques (see Chapter 18). Aliquot approximately equal volumes of the recovered effluent fluid into four separate 15 ml centrifuge tubes. The tubes are centrifuged at 600× g for 10 minutes. The supernatant is discarded and the residual pellets remaining at the bottom of the centrifuge tube are submitted for qPCR analysis, traditional microbial culture, and cytologic analysis. The pellet in the last centrifuge tube can be held for later analysis as needed.

       This is a brief explanation of the qPCR process, each laboratory that performs qPCR will have slight modifications designed to optimize laboratory efficiency that are beyond the scope of this chapter.

       The ultimate goal of qPCR is to produce a large quantity of a specific genetic sequence that is approximately 100–150 nucleotide bases in length. The nucleotide sequence can then be “decoded” and evaluated against the nucleotide sequence of known microorganisms.

       The first step is to extract the DNA from the bacterial or fungal cells. The cells are first lysed to separate the DNA from other cellular material. The DNA is isolated by centrifugation or binding to magnetic beads. The quality and quantity of DNA recovered in the extraction process is imperative to the success of the qPCR assay. DNA extraction that has a low efficiency results in zero or very limited quantities of DNA available for detection by the qPCR assay, leading to the possibility of a false‐negative diagnosis. Commercial kits are available that have been developed to maximize the DNA yield from a wide variety of samples.

       The DNA is placed into a special PCR tube.

       Primers consisting of short sequences of DNA, 15–30 nucleotides in length, designed to bind to the genetic sequence of interest, are added to the tube. Primers can be designed to detect all known organisms in a kingdom (i.e., the bacterial kingdom or the fungal kingdom). This may be advantageous as it allows detection of all known bacterial or fungal pathogens. However, it requires further diagnostic techniques to identify the specific organism.

       Alternatively, primers can be designed that are very specific and will detect a specific genus and species or even a specific gene. The advantage is that no further diagnostics are required. However, other potential pathogens could be missed if their DNA is not detected by a specific PCR assay.

       Forward and reverse primers are utilized to detect a small region of DNA. The DNA sequence between the two primers is subsequently replicated. In the case of equine endometritis, the goal is to detect either the 16S rDNA segment of bacteria or the 28S rDNA segment of fungal organisms.Eubacterial primers previously used for the detection of bacterial DNA in equine uterine samples are:forward: 5´‐TCCTACGGGAGGCAGCAGT‐3´reverse: 5´‐GGACTACCAGGGTATCTAATCCTGTT‐3´.Panfungal primers previously used for detection of fungal DNA in equine uterine samples are:forward: 5´‐GCATAT‐CAATAAGCGGAGGAAAAG‐3reverse: 5´‐TTAGCTTTAGATGRARTTTACCACC‐3´.

       Nucleotides (A, C, G, T) are added to the PCR tube.

       DNA polymerase is added to the tube. The purpose of the DNA polymerase is to read the code of the extracted DNA and attach matching nucleotides. Commercial kits containing DNA polymerase and nucleotides are available to maximize the efficiency of the replication process.

       The PCR tube containing the DNA of interest, PCR primers, DNA polymerase, nucleotides, and SYBR green (fluorescent dye) are placed into a thermal cycler or transferred into a 96‐well plate with other samples and loaded into a thermal cycler that will heat and cool the tube at specific times while monitoring the amplification of DNA within the tube.

       The initial step within the thermal cycler is to heat the tube to approximately 95°C, which will separate the DNA double helix into single‐stranded DNA.

       The tube is then cooled down to approximately 50°C (122°F), which will allow the primers to lock or anneal onto their target sequence, if it is present in the PCR tube after extraction.

       Subsequently, the tube is heated to approximately 72°C (162°F) for one to several minutes, which will activate the DNA polymerase to synthesize a copy of the DNA strand template. DNA polymerase binds to the primers and only adds nucleotides in a 5´ to 3´ progression. The length of time for this step is directly dependent on the length of the gene of interest, for example it will take longer to replicate 450 base pairs of DNA than 100 base pairs. As the DNA polymerase is replicating the area of interest, a fluorescent signal is released that can be detected by the thermocycler. A stronger signal indicates that there are more copies of DNA being replicated at that specific qPCR replication cycle (Ct cycle). The fluorescent signaling provides a quantitative estimate of the amount of DNA in the sample.

       The process is then repeated over multiple cycles and an amplification curve is generated (Figure 16.1). It is estimated that 40 cycles will produce over 1 billion copies of the targeted DNA sequence from one original DNA sequence. As noted above, copies will only be produced if the targeted DNA sequence was originally present in the initial tube after extraction. The entire time period for amplification is approximately 1–2 hours.Figure 16.1 Example of an amplification curve detecting fungal DNA in a clinical sample. The y axis is the relative amount of fluorescence detected and the x axis is the number of replication cycles (Ct). There is one clinical sample (third line from the left) and seven control samples being evaluated in this particular amplification curve. The samples are going through an exponential phase of DNA replication and a corresponding amount of fluorescent signal is produced. The cycle in which the fluorescent signal surpasses the threshold is considered the Ct value in which the sample was positive. The exponential phase continues for 4–6 replication cycles before entering a plateau or non‐exponential phase. The clinical sample had a Ct value of 17 which is near the control sample at Ct cycle 16 corresponding to approximately 1,000 CFU

Скачать книгу